News

Since the emergence of COVID-19 in late 2019, the gold standard in testing for the disease has been a nuclear-derived technique: real-time reverse transcription–polymerase chain reaction, or real-time ...
In order for a virus like the COVID-19 virus to be detected early in the body using real time RT–PCR, scientists need to convert the RNA to DNA. This is a process called ‘reverse transcription’. They ...
In particular, real-time reverse transcription (RT)-PCR has become the method of choice to rapidly and quantitatively examine the expression of specific genes. Scientists can readily detect as ...
This handbook explores key strategies for optimizing qPCR workflows, from sample preparation to data analysis, helping you ...
Real-time PCR, or quantitative qPCR, is a commonly used molecular biology lab technique to determine the actual amount of PCR product at a given cycle. For quantitative reverse transcription PCR ...
The paper is published in the journal Plant Health Progress. Miles and his team used real-time reverse transcription polymerase chain reaction, or RT-PCR—the same detection technology often used in ...
We have developed a two-step, real-time, quantitative assay, using the polymerase chain reaction with reverse transcription (RT-PCR) and based on SYBR Green I monitoring of PCR product ...
real-time PCR (qPCR), digital PCR (dPCR), reverse transcription PCR (RT-PCR), hot-start PCR, multiplex PCR, and other PCR techniques. The qPCR segment holds the largest share of the market.
The two tests – reverse transcription polymerase chain reaction (RT-PCR) and antigen rapid test kit (RTK-Ag) – require nasal or throat swab samples. Cancel anytime. No ads. Auto-renewal.
Note: Sequences in parenthesis represent probe sequence used in real-time ... PCR amplification was performed with a different forward primer (CATGCTATATTAAAAGAGTCTCA) but the same reverse primer.